Please use the bioinformatics tools to design these following items;
1. The real-time PCR primer and probe set(s) which can be used to distinguish between 2009 Swine-Origin Influenza A (H1N1)from other influenza subtypes.
Please also describe what are gene(s)/region(s) that you choose? And give us the reason why?
HA gene of influenza virus is chosen for primers design which can be used to distinguish between 2009
Swine-Origin Influenza A (H1N1)from other influenza subtypes. HA gene is chosen because HA and NA gene do not conserve between influenza subtype.
1. Retriving the HA nucleotide sequence of swine influenza from the http://www.ncbi.nlm.nih.gov/genomes/FLU/SwineFlu.html. Then save the HA gene as FASTA format.
1. >gi|283959917|gb|CY054548.1| Influenza A virus (A/Bayanulgii/9912/2009(H1N1)) segment 4 sequence
2. >gi|283806427|dbj|AB540654.1| Influenza A virus (A/Nagasaki/HA-46/2009(H1N1)) HA gene for hemagglutinin
3. >gi|283831904|gb|GU451254.1| Influenza A virus (A/Tver/IIV2969/2009(H1N1)) segment 4 hemagglutinin (HA) gene
4. >gi|283580642|gb|GU433033.1| Influenza A virus (A/Novosibirsk/02/2009(H1N1)) segment 4 hemagglutinin (HA) gene
5. >gi|283580624|gb|GU433025.1| Influenza A virus (A/Tomsk/03/2009(H1N1)) segment 4 hemagglutinin (HA) gene
2. Use BioEdit program to find conserved regions in the HA gene for template using. This process is needed because mutation rate in HA gene is high.
2.1 Open sequences with “BioEdit”
File> New Alignment> File> Import> Sequence alignment file> choose text file that save the FASTA sequences.
2.2 Find conserved regions in the HA sequences
choose all sequence> Accessory Application> ClastalW Multiple alignment> Run ClastalW> OK> Alignment> Find Conserved Regions> Start
The result will show how many conserved regions found and details of each region. Then choose one region as the template (Chosen template:Region 7: Position 850 to 1300,Segment Length: 451).
2.3 Then use the chosen one region as template for real-time PCR primer and probe design. Before the region is used as template, checking specificity of this region by alignment of this region is required by using “Nucleotide BLAST” in “NCBI” web page. And the result is shown that the chosen region is 2009 Swine-Origin Influenza A (H1N1).
3. Then use Primer3 web page to design real-time PCR primer and probe.
Paste the chosen template retriving from Bioedit > Pick left Primer> Pick hybridization probe> Pick right Primer> Pick Primers
The Primer3 output displays the best left, probe, and right primers and their characteristics (starting position, length, Tm, GC%) including representation of the location of the primers.
The size of PCR product is 172 bps
The left primer is GCCACAGGATTGAGGAATGT
The right primer is TGGCATTCTGTGTGCTCTTC
Probe oligo is CAGGGATGGTAGATGGATGG
4. Check the position of primers and probe by using “BioEdit” program.
file> open> open template, primers and probe sequence
4.1 Check forward primer and probe.
select template and forward primer (or probe)> Sequence> Pairwise alignment> Align two sequence (allow ends to slide).
The results is shown the location of position of the primer (or probe).
4.2 Check reverse primer. The reversion of nucleic acid is required.
– select template and reverse primer > Sequence> Nucleic acid> Reverse Complement
– select template and reverse primer > Sequence> Pairwise alignment> Align two sequence (allow ends to slide)
5. Check specificity of all primers and probe by Nucleotide BLAST in NCBI web page. The results are shown that each primer and probe are specific to 2009 Swine-Origin Influenza A (H1N1). And these primers and probe are not complementary to orther Influenza A virus.
Conclusion:
The BioEdit and Primer3 programs are used to design primers and probe and to locate the position of the primer and probe.
forward primer : GCCACAGGATTGAGGAATGT, locate at the position 994 of HA gene.
reverse primer : GAAGAGCACACAGAATGCCA, locate at the position 1165 of HA gene.
probe : CAGGGATGGTAGATGGATGG, locate at the position 1076 of HA gene.
product size is 172 bp.
2. The conventional PCR and sequencing primer set which can be used to identify oseltamivir resistance associated NA gene mutations: N1: H274Y.
Influenza A(H1N1) viruses bear a oseltamivir resistance conferring amino acid change of Histidine to Tyrosine at position 274 (H274Y) of the neuraminidase (NA).
1. The nucleotide sequence of neuraminidase is retrieved from GenBank.
– swine-originated influenza neuraminidase gene: accession number:FJ461637>>blastx>>ACJ53854
– oseltamivir resistance associated NA gene mutations: accession number:CY054656>>blastx>>ADB81411
2. Find out the 274 position of tyrosine(Y) in Bioedit program.
3.Click sequence on menu bar and choose Translate or Reverse-Translate (permanent) to reverse transcription for finding which DNA position belongs to this resistance. This mutation occurs C>T at position 820.
4.Primer3 program (http://frodo.wi.mit.edu/primer3) was used as the tool for design primer to identify the resistance. Sequencing of this mutation can be achieved by using primers covering this region. Nucleotide sequence of wild-type NA gene(accession number FJ461637) is applied to this program. The “targets” parameter have to be setted as 820,1.
5.The Primer3 output is shown below. the mutant position is contained in product.
Forward primer (Left primer): AATGGAAAAGGGGAAAGTGG
Reverse primer(Right primer): CCGGACCACAACTACCTGTT
Start position is 702 and end is 943.
The product size is 242 bps.
Asterisks show the included nucleotide that the mutate nucleotide is at position 820 .
Mingkhwan's Bioinformatics 