Assignment 3: Phylogenetic Tree

Who are the ancestors of the dinosaurs?
Science 1994 Nov 18;266(5188):1229-1232

A sequence of dinosaur’s mitochondrial cytochrome b:

cccttctattattcattctcattctattcgttattcttgtactccacacatccaaacaac
aaagcataatattccacccattgagtccattcctatcctgattcttagtccccgaacctt
ttacactcacatg

– Show step by step of how to do phylogenetic analysis with cytochrome b sequences.
– the structure of the tree and the position of the dinosaur sequence that might come close to these following species: Human, Dog, Rabbit, Rhinoceros, Dugong, Mouse, Whale, Bovine, Sicklebill, Chicken, Magpie, and Frog.

1. Search cytochrome b nucleotide sequence of 12 different species (Latin name) from NCBI. And then save these nucleotide sequences as FASTA format in one txt file (notepad).

Then edit all 13 sequences in notepad.

2. alignment of them are required by using ClustalX. And save the output file as phylip file.

3. Change a name of phy file into infile for using it in a phylip 3.69 program.

4. Paste infile in phylip 3.69 file and open Seqboot.

5. When open Seqboot in phylip 3.69 program, change its parameters: D=Molecular sequence, number of replicates (R) = 1000, and random number seed = 777. Type Y is OK and then press enter to quit. This output is outfile name and save the output file as below and then change its name as infile to be used with dnadist program.

The output is outfile.

change its outfile into infile name. (The previous infile is kept in wastefile folder)

6. After that open dnadist.exe and change its parameters:
– D and click Enter (change Distance from F84 to Kimura 2-parameter)
– L and click Enter (change Form matrix from Square to Lower-triangular)
– M and click Enter and to set multiple data sets or multiple weights by typing D and Enter for choosing multiple data sets. Then set multiple data sets = 1000 and Enter. Follow by typing Y and Enter to get output (outfile name) again. Press Enter to quit.

output is outfile name

7. Change outfile into infile name (previous infile is kept in waste file folder) and open Neighbor. Then change its parameters: L =Yes , M = select Data set = 1000, random seed = 777. And type Y is OK. The output is 2 file i.e. outfile and outtree.

Change parameters

The output is outfile and outtree.

8. Change files: outfile into infile and outtree into intree. Then open consense to construct Phylogeny Tree and type Y is OK. The output is outfile and outtree.

The output is outfile and outtree.

9. After that open this outtree with TreeView program.

The output is Phylogenetic tree.

10. If open intree file of neighbor with TreeView program, you can see Phylogenetic trees 1000 trees. (because of multiple data sets = 1000)

The output is Phylogenetic trees. (1000 trees)

This conclusion, the phylogenetic tree is contructed by using the Clustalx,Phylip and Treeview program. The phylogram showing the evolutionary relationship might not completely accuracy even using the bootstrapping program to estimate the most possibly accurated phologram because of the limitation of the dinosaur sequence and cytochrome b which evolves faster than other sequences not the whole genome one.

The result of this phylogenetic tree shows Dinosaur is related to Frog.